BBa_J64975 1 BBa_J64975 anti-glnG RNAi 2007-03-23T12:00:00Z 2015-05-08T01:08:17Z ''E. coli'' K-12 Cognate RNAi for glnG from -40 to +24. Last 10 bases on 3' end are not involved in binding with glnG mRNA, but rather serve as a binding site for an additional RNAi false false _98_ 0 1429 98 Not in stock false Wanted an RNAi that would overlap the RBS and start codon for glnG. As an additional constraint on the design, also wanted to allow regulation of the cytosolic levels of this RNAi via an additional RNAi. This was accomplished by extending the 3' end with a G/C-rich region. false Kristopher Kuchenbecker BBa_J64975_sequence 1 ttactgacgaccgcgttgcgacatacgcaggggcataaacaggaagcggcgcggctactcggctccccggcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z