BBa_J64976 1 BBa_J64976 anti-(anti-glnG) RNAi 2007-03-23T12:00:00Z 2015-05-08T01:08:17Z ''E. coli'' K-12 Cognate RNAi specific for BBa_J64975. false false _98_ 0 1429 98 Not in stock false This short RNAi is designed to mimic glnG mRNA in sequence except for a 5' insert that allows for preferential annealing with BBa_J64975 false Kristopher Kuchenbecker BBa_J64976_sequence 1 ggcgccggggagccgagtagccgcgccgcttcctgtttatgcccctgcgtatgtcgcaacgcggtcgtcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z