BBa_J64981 1 BBa_J64981 OmpR-P strong binding, regulatory region for Team Challenge03-2007 2007-03-25T11:00:00Z 2015-05-08T01:08:18Z Information for creation of this construct came from the following sorces: Yoshida et al. JBC 2006 Frank et al. JMB 1997 Rong et al. PNAS 1998 Merabet et al. Biochemistry 1995 Su et al. JBC 1998 Kedracka-Krok et al. JPC 1999 Kleinschmidt et al. Biochemistry 1988 Butler et al. JBC 1982 Jorgensen et al. JBC 1991 Hillen et al. JMB 1984 Head et al. JMB 1998 Contains the F1 consensus site from the OmpF regulator. Contains a LacI repressor consensus binding site between the -35 and -10 portions of a T7 core promoter region, and a TetR consensus binding site upstream of the -35 site. false false _98_ 0 1428 98 Not in stock false The weaker binding repressor binds upstream of the core promoter (upstream of -35), while the stronger binds inbetween the -35 and -10. false Sai Duriseti annotation1921599 1 TetR Consensus range1921599 1 21 39 annotation1921603 1 -10 range1921603 1 66 70 annotation1921598 1 Strong OmpR range1921598 1 1 20 annotation1921600 1 T7 RNA Polymerase Recognition range1921600 1 40 82 annotation1921601 1 LacI Consensus range1921601 1 46 65 annotation1921602 1 -35 range1921602 1 40 45 BBa_J64981_sequence 1 tttacttttggttacatatttccctatcagtgatagagattgacaaattgtgagcgctcacaatttaatacgactcactata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z