BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J69501 1 BBa_J69501 CI-repressible GFP Reporter 2007-03-28T11:00:00Z 2015-05-08T01:08:18Z Registry parts Released HQ 2013 Test Construct to valid Part I13504 before further assemblies false false _101_ 0 740 101 In stock false NA false James Brown component1923073 1 BBa_E0040 component1923076 1 BBa_B0012 component1923072 1 BBa_B0034 component1923067 1 BBa_R0051 component1923074 1 BBa_B0010 annotation1923067 1 BBa_R0051 range1923067 1 1 49 annotation1923072 1 BBa_B0034 range1923072 1 58 69 annotation1923076 1 BBa_B0012 range1923076 1 892 932 annotation1923074 1 BBa_B0010 range1923074 1 804 883 annotation1923073 1 BBa_E0040 range1923073 1 76 795 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2022 1 -10 range2022 1 38 43 annotation2025 1 OR2 range2025 1 1 17 annotation2024 1 OR1 range2024 1 25 41 annotation2023 1 -35 range2023 1 15 20 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J69501_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z