BBa_E2021 1 BBa_E2021 Cerulean (no linkers) 2010-12-13T12:00:00Z 2015-08-31T04:07:26Z PCR from E2020 CFP cerulean, codon-optimized for yeast. Derived from ECFP. Has single exponential decay kinetics, is at least 2X brighter than ECFP, and is more resistant to photobleaching. As E2020 without MATSG linkers false false _101_ 0 740 101 Not in stock false NA false James Brown BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2023 1 -35 range2023 1 15 20 annotation2022 1 -10 range2022 1 38 43 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2025 1 OR2 range2025 1 1 17 annotation2024 1 OR1 range2024 1 25 41 BBa_J69505 1 BBa_J69505 R0051 - Cerulean Reporter 2010-12-13T12:00:00Z 2015-05-08T01:08:19Z PCR/Gibson Assembly R0051 - Cerulean Reporter false false _101_ 0 740 101 Not in stock false NA false James Brown component2115092 1 BBa_B0034 component2115087 1 BBa_R0051 component2115093 1 BBa_E2021 component2115100 1 BBa_B0015 annotation2115092 1 BBa_B0034 range2115092 1 58 69 annotation2115100 1 BBa_B0015 range2115100 1 807 935 annotation2115093 1 BBa_E2021 range2115093 1 76 798 annotation2115087 1 BBa_R0051 range2115087 1 1 49 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_E2021_sequence 1 atggttagtaaaggagaagaacttttcactggagttgtcccaattctggttgaattggatggcgatgtcaatggccataagttttcggttagtggtgaaggagagggcgacgctacctatgggaagttaactttaaagttcatttgtactaccggtaagttaccagttccttggcctactttggtcacaacccttacatggggggtgcagtgctttgccagatatccggatcacatgaaacaacacgattttttcaaatccgctatgcctgaaggatatgtacaagaaagaaccatatttttcaaggatgacggcaactacaaaactagagccgaagttaaattcgaaggtgacacattggtaaatcgaattgagctcaaaggaatagattttaaggaagatggtaacatccttggtcataagttagagtataatgcaatttctgataacgtctacataactgcggataaacagaaaaatggtattaaagccaattttaaaattaggcataacatcgaagatgggagtgttcaacttgcagaccactaccaacaaaatacacccataggagacggtcccgtactgttgccagataaccattatctgtctacacaatctaaattaagcaaagatccaaatgaaaagcgtgaccacatggtgttgctagagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J69505_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggttagtaaaggagaagaacttttcactggagttgtcccaattctggttgaattggatggcgatgtcaatggccataagttttcggttagtggtgaaggagagggcgacgctacctatgggaagttaactttaaagttcatttgtactaccggtaagttaccagttccttggcctactttggtcacaacccttacatggggggtgcagtgctttgccagatatccggatcacatgaaacaacacgattttttcaaatccgctatgcctgaaggatatgtacaagaaagaaccatatttttcaaggatgacggcaactacaaaactagagccgaagttaaattcgaaggtgacacattggtaaatcgaattgagctcaaaggaatagattttaaggaagatggtaacatccttggtcataagttagagtataatgcaatttctgataacgtctacataactgcggataaacagaaaaatggtattaaagccaattttaaaattaggcataacatcgaagatgggagtgttcaacttgcagaccactaccaacaaaatacacccataggagacggtcccgtactgttgccagataaccattatctgtctacacaatctaaattaagcaaagatccaaatgaaaagcgtgaccacatggtgttgctagagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z