BBa_J70029 1 BBa_J70029 RBS + mCherry gene, optimized for expression in Me. florum and E. coli 2009-03-27T12:00:00Z 2015-05-08T01:08:20Z Synthesized by DNA 2.0, designed with Gene Designer. Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. RBS + mCherry gene, optimized for expression in Me. florum and E. coli. false true _42_41_48_1_ 0 6 48 Not in stock false Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. false Tom Knight annotation2002220 1 RBS range2002220 1 7 13 annotation2002219 1 MF-RED range2002219 1 19 699 BBa_J70029_sequence 1 tcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z