BBa_J70030 1 BBa_J70030 A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page 2008-12-07T12:00:00Z 2015-05-08T01:08:20Z this part is designed When placed in a BioBrick assembly and cut with the restriction enzyme PpiI, this part will direct the restriction enzymes to cut outside the BioBrick scar still in testing, uses restriction enzyme sites PpiI (2) PacI (2) MabI (2), will place in pSB1AK3 vector false false _41_ 0 1201 41 Not in stock false Can be used to removed protein tails for protein fusions, see BBF RFC 15 XXXXX^ XXX TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX XXX ATGATCAC ATGATCTA^XXXXX XXXXX^ TAA TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX ATT ATGATCAC ATGATCTA^XXXXX false Julie Norville annotation2000009 1 MabI 1 range2000009 1 8 14 annotation2000011 1 PacI3 range2000011 1 18 24 annotation2000010 1 PacI 1 range2000010 1 14 20 annotation2000008 1 PpiI 1 range2000008 1 4 7 annotation2000012 1 PacI 2 range2000012 1 22 29 annotation2000013 1 MabI 2 range2000013 1 30 36 annotation2000014 1 PpiI 2 range2000014 1 37 40 annotation2000015 1 PpiI 2 range2000015 1 46 48 BBa_J70030_sequence 1 ctggttcacctggttaattaattaattaaaccaggtgaacgtggtctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z