BBa_J70031 1 BBa_J70031 Linker for BioScaffold Parts, example of Gamma BioScaffold part 2008-12-12T12:00:00Z 2015-05-08T01:08:20Z designed Will use as a linker when fusing two BioScaffold parts, can be created as an oligo false false _41_ 0 1201 41 Not in stock false needs to be longer than 28 bp false Julie Norville annotation2000306 1 BBa Scar range2000306 1 8 15 annotation2000304 1 MabI range2000304 1 1 7 annotation2000305 1 MabI range2000305 1 16 22 BBa_J70031_sequence 1 accaggttactagagacctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z