BBa_J70012 1 BBa_J70012 A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page 2008-05-08T11:00:00Z 2015-05-08T01:08:20Z designed still in testing false false _41_ 0 1201 41 Not in stock false still in testing false Julie Norville annotation1963016 1 PsrI 1 range1963016 1 10 12 annotation1963021 1 AscI 1 range1963021 1 20 27 annotation1963022 1 AscI 2 range1963022 1 28 34 annotation1963015 1 PsrI 1 range1963015 1 1 3 annotation1963017 1 PsrI 2 range1963017 1 43 46 annotation1963018 1 Mab 1 range1963018 1 4 10 annotation1963020 1 Mab 2 range1963020 1 47 52 BBa_J70030 1 BBa_J70030 A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page 2008-12-07T12:00:00Z 2015-05-08T01:08:20Z this part is designed When placed in a BioBrick assembly and cut with the restriction enzyme PpiI, this part will direct the restriction enzymes to cut outside the BioBrick scar still in testing, uses restriction enzyme sites PpiI (2) PacI (2) MabI (2), will place in pSB1AK3 vector false false _41_ 0 1201 41 Not in stock false Can be used to removed protein tails for protein fusions, see BBF RFC 15 XXXXX^ XXX TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX XXX ATGATCAC ATGATCTA^XXXXX XXXXX^ TAA TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX ATT ATGATCAC ATGATCTA^XXXXX false Julie Norville annotation2000010 1 PacI 1 range2000010 1 14 20 annotation2000009 1 MabI 1 range2000009 1 8 14 annotation2000013 1 MabI 2 range2000013 1 30 36 annotation2000008 1 PpiI 1 range2000008 1 4 7 annotation2000012 1 PacI 2 range2000012 1 22 29 annotation2000011 1 PacI3 range2000011 1 18 24 annotation2000014 1 PpiI 2 range2000014 1 37 40 annotation2000015 1 PpiI 2 range2000015 1 46 48 BBa_J70031 1 BBa_J70031 Linker for BioScaffold Parts, example of Gamma BioScaffold part 2008-12-12T12:00:00Z 2015-05-08T01:08:20Z designed Will use as a linker when fusing two BioScaffold parts, can be created as an oligo false false _41_ 0 1201 41 Not in stock false needs to be longer than 28 bp false Julie Norville annotation2000306 1 BBa Scar range2000306 1 8 15 annotation2000304 1 MabI range2000304 1 1 7 annotation2000305 1 MabI range2000305 1 16 22 BBa_J70032 1 BBa_J70032 A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page) 2008-12-12T12:00:00Z 2015-05-08T01:08:20Z Designed Brings together a BioScaffold part that removes protein tails with one that removes protein heads in order to create a BioScaffold part that can help create protein fusions using standard assembly false false _41_ 0 1201 41 Not in stock false The part that links the two BioScaffold parts can be altered as desired--here I just wanted to leave at least 7 bp beyond the internal scars. false Julie Norville component2000365 1 BBa_J70012 component2000353 1 BBa_J70030 component2000357 1 BBa_J70031 annotation2000357 1 BBa_J70031 range2000357 1 57 78 annotation2000353 1 BBa_J70030 range2000353 1 1 48 annotation2000365 1 BBa_J70012 range2000365 1 87 138 BBa_J70032_sequence 1 ctggttcacctggttaattaattaattaaaccaggtgaacgtggtctctactagagaccaggttactagagacctggttactagagaacacctggtacagcaggtggcgcgccggcgcgccagctggtgaacaccagg BBa_J70031_sequence 1 accaggttactagagacctggt BBa_J70030_sequence 1 ctggttcacctggttaattaattaattaaaccaggtgaacgtggtctc BBa_J70012_sequence 1 aacacctggtacagcaggtggcgcgccggcgcgccagctggtgaacaccagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z