BBa_J70033 1 BBa_J70033 A BioMortar Part for Creating GSGS Protein Fusions (see Design page) 2008-12-12T12:00:00Z 2015-05-08T01:08:20Z Designed This part serves as a template for an annealed oligo can be used with part BBaJ70033 to create protein fusions using standard assembly and BioScaffold parts false false _41_ 0 1201 41 Not in stock false May not be able to add random sequence as I wish false Julie Norville annotation2000043 1 forward oligo range2000043 1 6 22 annotation2000046 1 use your sequence range2000046 1 18 22 annotation2000045 1 use your sequence range2000045 1 1 5 annotation2000044 1 reverse oligo range2000044 1 1 17 BBa_J70033_sequence 1 tttttggatccgggtccaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z