BBa_J70034 1 BBa_J70034 A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) 2008-12-27T12:00:00Z 2015-05-08T01:08:20Z Designed When placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the restriction enzyme to cut within the BioBrick scar still in testing, uses AarI (2) XmaI (1) See part design page or BBFRFC15, for details about use false false _41_ 0 1201 41 Not in stock false TBA false Julie Norville annotation2000049 1 XmaI range2000049 1 20 25 annotation2000048 1 AarI range2000048 1 38 44 annotation2000047 1 AarI range2000047 1 1 7 BBa_J70034_sequence 1 gcaggtggacaagaggagtcccgggagctggaactcccacctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z