BBa_J70040 1 BBa_J70040 A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed When placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the restriction enzyme to cut within the BioBrick scar still in testing, uses AarI (2), MabI(2), XmaI (1) * XmaI does not work in vector for BioScaffold part manipulations See part design page or BBFRFC15, for details about use false false _41_ 0 1201 41 Not in stock false See BBa_J70034, this is an analogous part except it uses MabI false Julie Norville annotation2000127 1 AarI range2000127 1 38 44 annotation2000128 1 XmaI range2000128 1 20 25 annotation2000130 1 MabI range2000130 1 29 34 annotation2000126 1 AarI range2000126 1 1 7 annotation2000129 1 MabI range2000129 1 11 17 BBa_J70040_sequence 1 gcaggtggacacctagggtcccgggagcaccaggtcccacctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z