BBa_J70046 1 BBa_J70046 6his part for use with BioScaffold parts ATG-6 his-GATCC(glycine serine)-TAA 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed. This 6 His prefix tag can be used with BBa_J70030 (PpiI) in fusing a 6 his tag to the N-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false It was designed to work with BBa_J70030 false Julie Norville annotation2000139 1 Start range2000139 1 1 3 annotation2000142 1 Stop range2000142 1 28 30 annotation2000143 1 6 his N-terminal tag range2000143 1 1 30 annotation2000140 1 6 his range2000140 1 4 21 annotation2000141 1 dna range2000141 1 22 26 BBa_J70046_sequence 1 atgcaccatcaccatcatcatggatcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z