BBa_J70030 1 BBa_J70030 A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page 2008-12-07T12:00:00Z 2015-05-08T01:08:20Z this part is designed When placed in a BioBrick assembly and cut with the restriction enzyme PpiI, this part will direct the restriction enzymes to cut outside the BioBrick scar still in testing, uses restriction enzyme sites PpiI (2) PacI (2) MabI (2), will place in pSB1AK3 vector false false _41_ 0 1201 41 Not in stock false Can be used to removed protein tails for protein fusions, see BBF RFC 15 XXXXX^ XXX TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX XXX ATGATCAC ATGATCTA^XXXXX XXXXX^ TAA TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX ATT ATGATCAC ATGATCTA^XXXXX false Julie Norville annotation2000008 1 PpiI 1 range2000008 1 4 7 annotation2000009 1 MabI 1 range2000009 1 8 14 annotation2000010 1 PacI 1 range2000010 1 14 20 annotation2000013 1 MabI 2 range2000013 1 30 36 annotation2000012 1 PacI 2 range2000012 1 22 29 annotation2000011 1 PacI3 range2000011 1 18 24 annotation2000015 1 PpiI 2 range2000015 1 46 48 annotation2000014 1 PpiI 2 range2000014 1 37 40 BBa_J70044 1 BBa_J70044 6his part for use with BioScaffold parts (G)GATCC(glycine serine)-6his-TAA 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed This 6 His suffix tag can be used with BBa_J70010 (PpiI) in fusing a 6 his tag to the C-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false This is 6 his suffix tag is designed to be used with BBa_J70010 (PpiI) BioScaffold parts. false Julie Norville annotation2000135 1 gly-ser range2000135 1 1 5 annotation2000136 1 6 his range2000136 1 6 23 annotation2000137 1 stop range2000137 1 24 26 annotation2000138 1 C terminal 6 his range2000138 1 1 26 BBa_J70080 1 BBa_J70080 BBa_J70030 (PpiI) protein fusion test part 2009-02-06T12:00:00Z 2015-05-08T01:08:20Z Designed This is used to test whether J70030 (PpiI) can be used to make protein fusions (can also be cut with BamHI.) false false _41_ 0 1201 41 Not in stock false Make sure the glycine serine portions come together. false Julie Norville component2000414 1 BBa_J70030 component2000419 1 BBa_J70044 component2000405 1 BBa_J70046 annotation2000414 1 BBa_J70030 range2000414 1 39 86 annotation2000405 1 BBa_J70046 range2000405 1 1 30 annotation2000419 1 BBa_J70044 range2000419 1 95 120 BBa_J70046 1 BBa_J70046 6his part for use with BioScaffold parts ATG-6 his-GATCC(glycine serine)-TAA 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed. This 6 His prefix tag can be used with BBa_J70030 (PpiI) in fusing a 6 his tag to the N-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false It was designed to work with BBa_J70030 false Julie Norville annotation2000142 1 Stop range2000142 1 28 30 annotation2000141 1 dna range2000141 1 22 26 annotation2000139 1 Start range2000139 1 1 3 annotation2000140 1 6 his range2000140 1 4 21 annotation2000143 1 6 his N-terminal tag range2000143 1 1 30 BBa_J70044_sequence 1 gatcccaccatcaccatcatcattaa BBa_J70030_sequence 1 ctggttcacctggttaattaattaattaaaccaggtgaacgtggtctc BBa_J70080_sequence 1 atgcaccatcaccatcatcatggatcctaatactagagctggttcacctggttaattaattaattaaaccaggtgaacgtggtctctactagaggatcccaccatcaccatcatcattaa BBa_J70046_sequence 1 atgcaccatcaccatcatcatggatcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z