BBa_J70090 1 BBa_J70090 BBa_J70032 (PpiI/PsrI) protein fusion test part 2009-02-06T12:00:00Z 2015-05-08T01:08:20Z Designed This is used to test whether the protein fusion Bioscaffold part (BBa_J70032, PpiI and PsrI) can be used to make protein fusions (can also be cut with BamHI) from BioBricks with normal heads and tails. Note that J70032 is a composite part made up of J70030, J70031, and J70012. false false _41_ 0 1201 41 Not in stock false Location of protein heads and tails and location of PpiI and PsrI cut sites. false Julie Norville component2000424 1 BBa_J70042 component2000437 1 BBa_J70031 component2000445 1 BBa_J70012 component2000433 1 BBa_J70030 component2000451 1 BBa_J70048 annotation2000445 1 BBa_J70012 range2000445 1 122 173 annotation2000451 1 BBa_J70048 range2000451 1 180 209 annotation2000437 1 BBa_J70031 range2000437 1 92 113 annotation2000433 1 BBa_J70030 range2000433 1 36 83 annotation2000424 1 BBa_J70042 range2000424 1 1 27 BBa_J70031 1 BBa_J70031 Linker for BioScaffold Parts, example of Gamma BioScaffold part 2008-12-12T12:00:00Z 2015-05-08T01:08:20Z designed Will use as a linker when fusing two BioScaffold parts, can be created as an oligo false false _41_ 0 1201 41 Not in stock false needs to be longer than 28 bp false Julie Norville annotation2000304 1 MabI range2000304 1 1 7 annotation2000305 1 MabI range2000305 1 16 22 annotation2000306 1 BBa Scar range2000306 1 8 15 BBa_J70012 1 BBa_J70012 A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page 2008-05-08T11:00:00Z 2015-05-08T01:08:20Z designed still in testing false false _41_ 0 1201 41 Not in stock false still in testing false Julie Norville annotation1963022 1 AscI 2 range1963022 1 28 34 annotation1963021 1 AscI 1 range1963021 1 20 27 annotation1963018 1 Mab 1 range1963018 1 4 10 annotation1963017 1 PsrI 2 range1963017 1 43 46 annotation1963016 1 PsrI 1 range1963016 1 10 12 annotation1963020 1 Mab 2 range1963020 1 47 52 annotation1963015 1 PsrI 1 range1963015 1 1 3 BBa_J70042 1 BBa_J70042 6his part for use with BioScaffold parts ATG-6his-GGATCC (glycine serine) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed. This 7 His prefix tag and be used with BBa_J70010 (PpiI) and BBa_J70012 (PsrI) in fusing a 6 his tag to the N-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false This can be used when creating standard fusions between the 6 his tag and protein parts using BioScaffold parts. false Julie Norville annotation2000132 1 6 his range2000132 1 4 21 annotation2000133 1 gly-ser range2000133 1 22 27 annotation2000131 1 Start range2000131 1 1 3 annotation2000134 1 N terminal 6 his range2000134 1 1 27 BBa_J70048 1 BBa_J70048 6his part for use with BioScaffold parts ATG-GGATCC (glycine serine)-6 His-TAA 2009-02-05T12:00:00Z 2015-05-08T01:08:20Z Designed. This 6 His suffix tag can be used with BBa_J70012 (PsrI) in fusing a 6 his tag to the C-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K4. false false _41_ 0 1201 41 Not in stock false Designed. false Julie Norville annotation2000265 1 gly-ser range2000265 1 4 9 annotation2000264 1 6 his range2000264 1 10 27 annotation2000266 1 stop range2000266 1 28 30 annotation2000262 1 Start range2000262 1 1 3 annotation2000263 1 C terminal his tag range2000263 1 1 30 BBa_J70030 1 BBa_J70030 A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page 2008-12-07T12:00:00Z 2015-05-08T01:08:20Z this part is designed When placed in a BioBrick assembly and cut with the restriction enzyme PpiI, this part will direct the restriction enzymes to cut outside the BioBrick scar still in testing, uses restriction enzyme sites PpiI (2) PacI (2) MabI (2), will place in pSB1AK3 vector false false _41_ 0 1201 41 Not in stock false Can be used to removed protein tails for protein fusions, see BBF RFC 15 XXXXX^ XXX TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX XXX ATGATCAC ATGATCTA^XXXXX XXXXX^ TAA TACTAGAG BioScaffold Part BBa_J70030 TACTAGAT XXXXX^ ^XXXXX ATT ATGATCAC ATGATCTA^XXXXX false Julie Norville annotation2000010 1 PacI 1 range2000010 1 14 20 annotation2000009 1 MabI 1 range2000009 1 8 14 annotation2000013 1 MabI 2 range2000013 1 30 36 annotation2000011 1 PacI3 range2000011 1 18 24 annotation2000008 1 PpiI 1 range2000008 1 4 7 annotation2000015 1 PpiI 2 range2000015 1 46 48 annotation2000014 1 PpiI 2 range2000014 1 37 40 annotation2000012 1 PacI 2 range2000012 1 22 29 BBa_J70090_sequence 1 atgcaccatcaccatcatcatggatcctactagagctggttcacctggttaattaattaattaaaccaggtgaacgtggtctctactagagaccaggttactagagacctggttactagagaacacctggtacagcaggtggcgcgccggcgcgccagctggtgaacaccaggtactagatgggatcccaccatcaccatcatcattaa BBa_J70042_sequence 1 atgcaccatcaccatcatcatggatcc BBa_J70031_sequence 1 accaggttactagagacctggt BBa_J70048_sequence 1 atgggatcccaccatcaccatcatcattaa BBa_J70030_sequence 1 ctggttcacctggttaattaattaattaaaccaggtgaacgtggtctc BBa_J70012_sequence 1 aacacctggtacagcaggtggcgcgccggcgcgccagctggtgaacaccagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z