BBa_J70042 1 BBa_J70042 6his part for use with BioScaffold parts ATG-6his-GGATCC (glycine serine) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed. This 7 His prefix tag and be used with BBa_J70010 (PpiI) and BBa_J70012 (PsrI) in fusing a 6 his tag to the N-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false This can be used when creating standard fusions between the 6 his tag and protein parts using BioScaffold parts. false Julie Norville annotation2000134 1 N terminal 6 his range2000134 1 1 27 annotation2000131 1 Start range2000131 1 1 3 annotation2000133 1 gly-ser range2000133 1 22 27 annotation2000132 1 6 his range2000132 1 4 21 BBa_J70048 1 BBa_J70048 6his part for use with BioScaffold parts ATG-GGATCC (glycine serine)-6 His-TAA 2009-02-05T12:00:00Z 2015-05-08T01:08:20Z Designed. This 6 His suffix tag can be used with BBa_J70012 (PsrI) in fusing a 6 his tag to the C-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K4. false false _41_ 0 1201 41 Not in stock false Designed. false Julie Norville annotation2000265 1 gly-ser range2000265 1 4 9 annotation2000263 1 C terminal his tag range2000263 1 1 30 annotation2000266 1 stop range2000266 1 28 30 annotation2000262 1 Start range2000262 1 1 3 annotation2000264 1 6 his range2000264 1 10 27 BBa_J70100 1 BBa_J70100 Library Vector Test Plasmid for J70040 2009-02-06T12:00:00Z 2015-05-08T01:08:20Z Designed This is used to test whether J70040 (AarI, MabI) can be used to make screening vectors. false false _41_ 0 1201 41 Not in stock false Locations of AarI cutsites. false Julie Norville component2000468 1 BBa_J70048 component2000462 1 BBa_J70040 component2000456 1 BBa_J70042 annotation2000462 1 BBa_J70040 range2000462 1 36 80 annotation2000456 1 BBa_J70042 range2000456 1 1 27 annotation2000468 1 BBa_J70048 range2000468 1 87 116 BBa_J70040 1 BBa_J70040 A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed When placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the restriction enzyme to cut within the BioBrick scar still in testing, uses AarI (2), MabI(2), XmaI (1) * XmaI does not work in vector for BioScaffold part manipulations See part design page or BBFRFC15, for details about use false false _41_ 0 1201 41 Not in stock false See BBa_J70034, this is an analogous part except it uses MabI false Julie Norville annotation2000126 1 AarI range2000126 1 1 7 annotation2000127 1 AarI range2000127 1 38 44 annotation2000128 1 XmaI range2000128 1 20 25 annotation2000129 1 MabI range2000129 1 11 17 annotation2000130 1 MabI range2000130 1 29 34 BBa_J70042_sequence 1 atgcaccatcaccatcatcatggatcc BBa_J70048_sequence 1 atgggatcccaccatcaccatcatcattaa BBa_J70040_sequence 1 gcaggtggacacctagggtcccgggagcaccaggtcccacctgca BBa_J70100_sequence 1 atgcaccatcaccatcatcatggatcctactagaggcaggtggacacctagggtcccgggagcaccaggtcccacctgcatactagatgggatcccaccatcaccatcatcattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z