BBa_J70042 1 BBa_J70042 6his part for use with BioScaffold parts ATG-6his-GGATCC (glycine serine) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed. This 7 His prefix tag and be used with BBa_J70010 (PpiI) and BBa_J70012 (PsrI) in fusing a 6 his tag to the N-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false This can be used when creating standard fusions between the 6 his tag and protein parts using BioScaffold parts. false Julie Norville annotation2000134 1 N terminal 6 his range2000134 1 1 27 annotation2000132 1 6 his range2000132 1 4 21 annotation2000131 1 Start range2000131 1 1 3 annotation2000133 1 gly-ser range2000133 1 22 27 BBa_J70102 1 BBa_J70102 Left 6 his test part for library construction part. 2009-03-01T12:00:00Z 2015-05-08T01:08:20Z Testing Testing false false _41_ 0 1201 41 Not in stock false Testing false Julie Norville component2001775 1 BBa_J70042 component2001781 1 BBa_J70040 annotation2001775 1 BBa_J70042 range2001775 1 1 27 annotation2001781 1 BBa_J70040 range2001781 1 36 80 BBa_J70040 1 BBa_J70040 A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed When placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the restriction enzyme to cut within the BioBrick scar still in testing, uses AarI (2), MabI(2), XmaI (1) * XmaI does not work in vector for BioScaffold part manipulations See part design page or BBFRFC15, for details about use false false _41_ 0 1201 41 Not in stock false See BBa_J70034, this is an analogous part except it uses MabI false Julie Norville annotation2000128 1 XmaI range2000128 1 20 25 annotation2000126 1 AarI range2000126 1 1 7 annotation2000127 1 AarI range2000127 1 38 44 annotation2000130 1 MabI range2000130 1 29 34 annotation2000129 1 MabI range2000129 1 11 17 BBa_J70042_sequence 1 atgcaccatcaccatcatcatggatcc BBa_J70102_sequence 1 atgcaccatcaccatcatcatggatcctactagaggcaggtggacacctagggtcccgggagcaccaggtcccacctgca BBa_J70040_sequence 1 gcaggtggacacctagggtcccgggagcaccaggtcccacctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z