BBa_J70104 1 BBa_J70104 Right 6 his test part for library construction part. 2009-03-01T12:00:00Z 2015-05-08T01:08:20Z Testing Testing false false _41_ 0 1201 41 Not in stock false Testing false Julie Norville component2001793 1 BBa_J70048 component2001787 1 BBa_J70040 annotation2001793 1 BBa_J70048 range2001793 1 52 81 annotation2001787 1 BBa_J70040 range2001787 1 1 45 BBa_J70040 1 BBa_J70040 A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed When placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the restriction enzyme to cut within the BioBrick scar still in testing, uses AarI (2), MabI(2), XmaI (1) * XmaI does not work in vector for BioScaffold part manipulations See part design page or BBFRFC15, for details about use false false _41_ 0 1201 41 Not in stock false See BBa_J70034, this is an analogous part except it uses MabI false Julie Norville annotation2000128 1 XmaI range2000128 1 20 25 annotation2000126 1 AarI range2000126 1 1 7 annotation2000129 1 MabI range2000129 1 11 17 annotation2000127 1 AarI range2000127 1 38 44 annotation2000130 1 MabI range2000130 1 29 34 BBa_J70048 1 BBa_J70048 6his part for use with BioScaffold parts ATG-GGATCC (glycine serine)-6 His-TAA 2009-02-05T12:00:00Z 2015-05-08T01:08:20Z Designed. This 6 His suffix tag can be used with BBa_J70012 (PsrI) in fusing a 6 his tag to the C-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K4. false false _41_ 0 1201 41 Not in stock false Designed. false Julie Norville annotation2000266 1 stop range2000266 1 28 30 annotation2000264 1 6 his range2000264 1 10 27 annotation2000263 1 C terminal his tag range2000263 1 1 30 annotation2000265 1 gly-ser range2000265 1 4 9 annotation2000262 1 Start range2000262 1 1 3 BBa_J70104_sequence 1 gcaggtggacacctagggtcccgggagcaccaggtcccacctgcatactagatgggatcccaccatcaccatcatcattaa BBa_J70048_sequence 1 atgggatcccaccatcaccatcatcattaa BBa_J70040_sequence 1 gcaggtggacacctagggtcccgggagcaccaggtcccacctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z