BBa_J70042 1 BBa_J70042 6his part for use with BioScaffold parts ATG-6his-GGATCC (glycine serine) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed. This 7 His prefix tag and be used with BBa_J70010 (PpiI) and BBa_J70012 (PsrI) in fusing a 6 his tag to the N-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K3. false false _41_ 0 1201 41 Not in stock false This can be used when creating standard fusions between the 6 his tag and protein parts using BioScaffold parts. false Julie Norville annotation2000132 1 6 his range2000132 1 4 21 annotation2000131 1 Start range2000131 1 1 3 annotation2000134 1 N terminal 6 his range2000134 1 1 27 annotation2000133 1 gly-ser range2000133 1 22 27 BBa_J70034 1 BBa_J70034 A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) 2008-12-27T12:00:00Z 2015-05-08T01:08:20Z Designed When placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the restriction enzyme to cut within the BioBrick scar still in testing, uses AarI (2) XmaI (1) See part design page or BBFRFC15, for details about use false false _41_ 0 1201 41 Not in stock false TBA false Julie Norville annotation2000048 1 AarI range2000048 1 38 44 annotation2000047 1 AarI range2000047 1 1 7 annotation2000049 1 XmaI range2000049 1 20 25 BBa_J70048 1 BBa_J70048 6his part for use with BioScaffold parts ATG-GGATCC (glycine serine)-6 His-TAA 2009-02-05T12:00:00Z 2015-05-08T01:08:20Z Designed. This 6 His suffix tag can be used with BBa_J70012 (PsrI) in fusing a 6 his tag to the C-terminus of a protein. This part is still in testing. During the BioScaffold part excision, it should be placed in pSB2K4. false false _41_ 0 1201 41 Not in stock false Designed. false Julie Norville annotation2000262 1 Start range2000262 1 1 3 annotation2000266 1 stop range2000266 1 28 30 annotation2000264 1 6 his range2000264 1 10 27 annotation2000265 1 gly-ser range2000265 1 4 9 annotation2000263 1 C terminal his tag range2000263 1 1 30 BBa_J70110 1 BBa_J70110 Library Vector Test Plasmid for J70034 2009-02-06T12:00:00Z 2015-05-08T01:08:20Z Designed This is used to test whether J70034 (AarI, XmaI) can be used to make screening vectors. false false _41_ 0 1201 41 Not in stock false Where AarI digests false Julie Norville component2000483 1 BBa_J70048 component2000473 1 BBa_J70042 component2000477 1 BBa_J70034 annotation2000483 1 BBa_J70048 range2000483 1 87 116 annotation2000477 1 BBa_J70034 range2000477 1 36 80 annotation2000473 1 BBa_J70042 range2000473 1 1 27 BBa_J70034_sequence 1 gcaggtggacaagaggagtcccgggagctggaactcccacctgca BBa_J70110_sequence 1 atgcaccatcaccatcatcatggatcctactagaggcaggtggacaagaggagtcccgggagctggaactcccacctgcatactagatgggatcccaccatcaccatcatcattaa BBa_J70042_sequence 1 atgcaccatcaccatcatcatggatcc BBa_J70048_sequence 1 atgggatcccaccatcaccatcatcattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z