BBa_J70050 1 BBa_J70050 Left Library Insert Preparation Part (To use with J70052, and J70040) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed Still in Testing Surround a part with J70050 and J70052, digest with AarI Insert into a vector that contained J70040, and had J70040 removed by AarI and MabI false false _41_ 0 1201 41 Not in stock false Not sure if single AarI site will be good enough false Julie Norville annotation2000145 1 Spacer range2000145 1 8 11 annotation2000144 1 AarI range2000144 1 1 7 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_J70120 1 BBa_J70120 Library Insert Test Plasmid for J70050 and J70052 2009-02-06T12:00:00Z 2015-05-08T01:08:20Z Designed This is used to test whether J70050 and J70052 (AarI, MabI) can be used to make insert for screening vectors. false false _41_ 0 1201 41 Not in stock false Location of AarI sites false Julie Norville component2000492 1 BBa_J70052 component2000486 1 BBa_J70050 component2000488 1 BBa_B0030 annotation2000492 1 BBa_J70052 range2000492 1 43 52 annotation2000486 1 BBa_J70050 range2000486 1 1 11 annotation2000488 1 BBa_B0030 range2000488 1 20 34 BBa_J70052 1 BBa_J70052 Right Library Insert Preparation Part (To use with J70050, and J70040) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed Still in Testing Surround a part with J70050 and J70052, digest with AarI Insert into a vector that contained J70040 and had J70040 removed by AarI and MabI false false _41_ 0 1201 41 Not in stock false Not sure if one AarI site on each site will be enough. false Julie Norville annotation2000146 1 Spacer range2000146 1 1 3 annotation2000147 1 AarI range2000147 1 4 10 BBa_J70050_sequence 1 cacctgcatat BBa_J70052_sequence 1 atagcaggtg BBa_B0030_sequence 1 attaaagaggagaaa BBa_J70120_sequence 1 cacctgcatattactagagattaaagaggagaaatactagagatagcaggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z