BBa_J70210 1 BBa_J70210 A BioScaffold Part (Uses PpiI), similar to J70010 see Part Design Page 2009-03-25T12:00:00Z 2015-05-08T01:08:20Z designed When placed in a BioBrick assembly and cut with the restriction enzyme PpiI, this part will direct the restriction enzyme to cut outside the BioBrick scar still in testing, uses PpiI (2) PacI (2) MabI (2), currently in pSB1AK3 vector See part design page or BBFRFC15, for details about use This part can be made with the following oligos, which can be annealed and placed into an EcoRI/SpeI cut vector: TM=54.3 TM=53.8 TM=58.6 EcoRINotI XbaI SpeI AATTCGCGGCCGCTTCTAGAG| gagagctggttcaccaggtt aattaattaattaaacctggtgaacgtggtctc ta (ctag) G | at gatc gaattcgcggccgcttctagag ta ctagtagcggccgctgcag BioBrick Prefix gagagctggttcaccaggtt aattaattaattaaacctggtgaacgtggtctc BioBrick Suffix J70010 sequence Oligos for J70010.2 (3/17/09) Forward 1.2 (TM=54.3): 5'-AATTCGCGGCCGCTTCTAGAG-3' (this oligo corrects an error from version 1.1) Forward 2.2 (TM1=53.8, TM2=58.6): 5'-gagagctggttcaccaggttaattaattaattaaacctggtgaacgtggtctcta-3' Reverse 2.2 (TM1=53.8,54.3): 5'-aacctggtgaaccagctctcCTCTAGAAGCGGCCGCG-3' (This oligo corrects a version 2.1 error) Reverse 1.2: 5'-ctagtagagaccacgttcaccaggtttaattaattaatt-3' Obsolete Versions: Forward 1.1: AATTCGCGGCCGCTACTAGAG (bug) Forward 2.1: gagagctggttcaccaggttaattaattaattaaacctggtgaacgtggtctcta Reverse 1.1: CTAGTAGAgaccacgttcaccaggtttaattaattaatt Reverse 2.1: aacctggtgaaccagctctcCTCTAGTAGCGGCCGCG (bug) false false _41_ 0 1201 41 Not in stock false Same as J70010 except uses AscI instead of PacI ------------------ Can be used to cut at 0 offset from the BioBrick scar on either side, see BBF RFC15 TACTAGAG and TACAGAT represent sequences for BioBrick scars that are created when two BioBrick parts are fused together. ^s represent restriction enzyme cut sites. General Function XXXXX XXXXX^TACTAGAG BioScaffold Part BBa_J70010 TACTAGAT XXXXX^XXXXX XXXXX^XXXXX ATGATCAC ATGATCTA^XXXXX XXXXX Function when the right part is a protein part. XXXXX XXXXX^TACTAGAG BioScaffold Part BBa_J70010 TACTAGAT GXXXX^XXXXX XXXXX^XXXXX ATGATCAC ATGATCTA^CXXXX XXXXX What happens after cutting with MabI or PacI and purifying with either gel purification or a Qiagen PCR cleanup spin column General Case XXXXX XXXXX^ ^XXXXX XXXXX^ ^XXXXX XXXXX Case when right part is a protein part XXXXX XXXXX^ ^XXXXX XXXXX^ ^CXXXX XXXXX false Julie Norville annotation2002107 1 AscI range2002107 1 20 27 annotation2002102 1 PpiI range2002102 1 9 12 annotation2002108 1 AscI range2002108 1 28 35 annotation2002103 1 PpiI range2002103 1 43 46 annotation2002105 1 MabI range2002105 1 4 9 annotation2002106 1 dna range2002106 1 45 51 annotation2002101 1 PpiI range2002101 1 1 3 annotation2002104 1 PpiI range2002104 1 52 54 BBa_J70210_sequence 1 gagacctggttcagcaggtggcgcgccggcgcgccagctggtgaaccaggtctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z