BBa_J70300 1 BBa_J70300 Strong Me. florum promoter 2009-03-28T12:00:00Z 2015-05-08T01:08:20Z 53556 53678 approximately from NC_006055 Promoter from the highly expressed pdh e1 gene (mfl039) of Me. florum. Contains three overlapping promoters with near consensus sequence and an UP sequence. false false _42_41_48_1_ 0 6 48 Not in stock false None. false Tom Knight annotation2002223 1 -35 range2002223 1 54 60 annotation2002222 1 -10 range2002222 1 77 82 annotation2002225 1 -35 range2002225 1 43 48 annotation2002224 1 -10 range2002224 1 67 73 annotation2002226 1 t-c mutation range2002226 1 16 16 BBa_J70300_sequence 1 cagttaaaaacattccagataagtttgcattaaaagaaatatttggtgataactttgaagcagaagatattttgaatttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z