BBa_J70301 1 BBa_J70301 Heat shock inducible promoter for Me. florum 2009-03-29T12:00:00Z 2015-05-08T01:08:20Z PCR from lon protease promoter of NC_006055. Promoter inhibited by the gram + hrcA gene product in normal temperature conditions. Promoter from the lon protease, false false _42_41_48_1_ 0 6 48 Not in stock false Low gc content, difficult PCR primers false Tom Knight annotation2002228 1 -35 range2002228 1 73 79 annotation2002227 1 -10 range2002227 1 94 100 annotation2002229 1 hrcA binding site range2002229 1 53 80 BBa_J70301_sequence 1 caaataacggataattataaaataaaacaaacctgataaaggtttttttatttttagcactctactattgtaattgctaaacaatatgataatatatatttaaccacatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z