BBa_J70029 1 BBa_J70029 RBS + mCherry gene, optimized for expression in Me. florum and E. coli 2009-03-27T12:00:00Z 2015-05-08T01:08:20Z Synthesized by DNA 2.0, designed with Gene Designer. Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. RBS + mCherry gene, optimized for expression in Me. florum and E. coli. false true _42_41_48_1_ 0 6 48 Not in stock false Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. false Tom Knight annotation2002219 1 MF-RED range2002219 1 19 699 annotation2002220 1 RBS range2002220 1 7 13 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_J70313 1 BBa_J70313 R0040 (tetR), J70029 (RBS+mcherry) 2009-06-16T11:00:00Z 2015-05-08T01:08:21Z R0040, J70029 analogue of BBa_I13516 (promoter, rbs+FPb) with a new promotor and fluorescent proten, this is a reporter fragment since it does not have a terminator false false _41_ 0 1201 41 Not in stock false none false Julie Norville component2005592 1 BBa_J70029 component2005585 1 BBa_R0040 annotation2005592 1 BBa_J70029 range2005592 1 63 761 annotation2005585 1 BBa_R0040 range2005585 1 1 54 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J70313_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa BBa_J70029_sequence 1 tcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z