BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_J70029 1 BBa_J70029 RBS + mCherry gene, optimized for expression in Me. florum and E. coli 2009-03-27T12:00:00Z 2015-05-08T01:08:20Z Synthesized by DNA 2.0, designed with Gene Designer. Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. RBS + mCherry gene, optimized for expression in Me. florum and E. coli. false true _42_41_48_1_ 0 6 48 Not in stock false Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. false Tom Knight annotation2002219 1 MF-RED range2002219 1 19 699 annotation2002220 1 RBS range2002220 1 7 13 BBa_J70319 1 BBa_J70319 Maximum YFP output, (TetR, RBS+mcherry, B0014) 2009-06-16T11:00:00Z 2015-05-08T01:08:21Z R0040, J70314 analogue of BBa_I13522 R0040 (tetR), J70314 (mcherry translational unit) false false _41_ 0 1201 41 Not in stock false none false Julie Norville component2005661 1 BBa_B0012 component2005665 1 BBa_B0011 component2005653 1 BBa_R0040 component2005660 1 BBa_J70029 annotation2005653 1 BBa_R0040 range2005653 1 1 54 annotation2005665 1 BBa_B0011 range2005665 1 819 864 annotation2005660 1 BBa_J70029 range2005660 1 63 761 annotation2005661 1 BBa_B0012 range2005661 1 770 810 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_J70319_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J70029_sequence 1 tcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z