BBa_J70332 1 BBa_J70332 B1004.f.1: B1004 forward oligo part (single stranded) 2009-06-17T11:00:00Z 2015-05-08T01:08:21Z B1004 see J70333 for reverse part false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70332_sequence 1 cgccgaaaaccccgcttcggcggggttttgccgctagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z