BBa_J70334 1 BBa_J70334 B1005.f.1: B1005 forward oligo part (single stranded) 2009-06-17T11:00:00Z 2015-05-08T01:08:21Z B1005 See J70335 for reverse part false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70334_sequence 1 cgccgcaaaccccgcttcggcggggtttcgccgctagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z