BBa_J70339 1 BBa_J70339 B1007.r.1: B1007 reverse oligo part (single stranded) 2009-06-17T11:00:00Z 2015-05-08T01:08:21Z B1007 see J70338 for forward part false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70339_sequence 1 gcgaaaaaaccccgccctgtcaggggcggggttttttgcgtctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z