BBa_J70342 1 BBa_J70342 J70315psri.f.1: J70315 psri forward part for pcr of S03621 (single stranded) 2009-06-17T11:00:00Z 2015-05-08T01:08:21Z designed using Ginko pcr primer generator forward1 (TM57.8) (J70315psri.f.1) see J70343 for reverse pcr part probably need to cut the part with XbaI, PstI to place in a vector false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70342_sequence 1 gccgcttctagaggcctgaacggcctttacaaagaggagaaatactagatggtgagcaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z