BBa_J70343 1 BBa_J70343 J70315psri.r.1: J70315 psri reverse part for pcr of S03621 (single stranded) 2009-06-17T11:00:00Z 2015-05-08T01:08:21Z designed using Ginkgo tool see J70342 for forward primer of the part this probably should be cut with XbaI PstI after pcr false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70343_sequence 1 tcttcctgcagcggccgctactagtaaaggccgttcagagcgttcaccgacaaacaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z