BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_J70356 1 BBa_J70356 TetR promoter, mcherry, B1003, GFP 2009-06-21T11:00:00Z 2015-05-08T01:08:21Z J70313, B1003, J70325 J70313 (mcherry reporter frag), B1003 (terminator), J70325 (gfp translational unit) false false _41_ 0 1201 41 Not in stock false none false Julie Norville component2006427 1 BBa_R0040 component2006448 1 BBa_B0011 component2006439 1 BBa_B1003 component2006444 1 BBa_B0012 component2006443 1 BBa_E0040 component2006434 1 BBa_J70029 component2006441 1 BBa_B0034 annotation2006441 1 BBa_B0034 range2006441 1 812 823 annotation2006434 1 BBa_J70029 range2006434 1 63 761 annotation2006443 1 BBa_E0040 range2006443 1 830 1549 annotation2006427 1 BBa_R0040 range2006427 1 1 54 annotation2006448 1 BBa_B0011 range2006448 1 1607 1652 annotation2006444 1 BBa_B0012 range2006444 1 1558 1598 annotation2006439 1 BBa_B1003 range2006439 1 770 803 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B1003 1 BBa_B1003 Terminator (artificial, small, %T~=80) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z antiquity Released HQ 2013 Artifical terminator, estimated %T~=80 6bp stem, 4nt loop Bidirectional, estimated reverse %T=40 false false _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 5 residues. true Haiyao Huang annotation1898418 1 PolyA range1898418 1 5 9 annotation1898419 1 PolyA range1898419 1 26 30 annotation1898417 1 stem loop range1898417 1 10 25 annotation1898416 1 B1003 range1898416 1 1 34 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_J70029 1 BBa_J70029 RBS + mCherry gene, optimized for expression in Me. florum and E. coli 2009-03-27T12:00:00Z 2015-05-08T01:08:20Z Synthesized by DNA 2.0, designed with Gene Designer. Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. RBS + mCherry gene, optimized for expression in Me. florum and E. coli. false true _42_41_48_1_ 0 6 48 Not in stock false Initial tag of mCherry replaced with original AA sequence to eliminate the cryptic RBS + start internal to the coding sequence. Removed PvuII and Sau3AI sequences. Use of the compromise codon table guarantees no CGG codons and the use of TGG for tryptophan. false Tom Knight annotation2002220 1 RBS range2002220 1 7 13 annotation2002219 1 MF-RED range2002219 1 19 699 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B1003_sequence 1 cgccaaaaaccccgcttcggcggggtttttccgc BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_J70029_sequence 1 tcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J70356_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataatactagagcgccaaaaaccccgcttcggcggggtttttccgctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z