BBa_J70436 1 BBa_J70436 Forward oligo part for testing J70428, J70429, J70430 2009-08-15T11:00:00Z 2015-05-08T01:08:22Z designed see complementary reverse oligo part J70437 false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70436_sequence 1 gccgcttctagagtatatatactagtagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z