BBa_J70458 1 BBa_J70458 yfp RBS, {0,5;15,10} family member - B0031 simulator (forward oligo) 2009-08-16T11:00:00Z 2015-05-08T01:08:23Z designed These oligo parts can be used for converting any pathway of the form (Promoter X)-(Bioscaffold part {0,5;5,0})-YFP to (Promoter X)-(RBS level Y)-YFP. Note that this removes the scar on the right side of the RBS, except when traditional BioBrick derived RBSes have been used (for example <partinfo>B0034</partinfo>.) Also gtg starts are removed to make the RBS more predictable. Form of insert: {promoter} ta ctaga ^ g {rbs master sequence} a tgagc ^ {rest of YFP (E0030)} {promoter} at ^ gatct c {rbs master sequence} t^ actcg {rest of YFP (E0030)} Forward oligo: g {rbs master sequence} a tgagc Reverse oligo: Reverse complement of (ctagag {rbs master sequence} a) false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70458_sequence 1 gtcacacaggaaacctactagatggtgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z