BBa_J70585 1 BBa_J70585 Lpp promoter (sequence only-- not shifted relative to scar) 2010-06-12T11:00:00Z 2015-05-08T01:08:24Z from wenshe liu paper listed above This is from: A Convenient Method for Genetic Incorporation of Multiple Noncanonical Amino Acids into One Protein in Escherichia Coli Ying Huang, William K. Russell, Wei Wan, Pei-Jing Pai, David H. Russell, and Wenshe Liu Would be useful to check this reference if want to produce a version that is okay with scar: In vivo circular RNA production using a constitutive promoter for high-level expression So Umekage, a, and Yo Kikuchia false false _41_ 0 1201 41 Not in stock false did not take into account scar sequence for now false Julie Norville BBa_J70585_sequence 1 cccatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z