BBa_J70612 1 BBa_J70612 RFC12 Double Terminator 2010-07-19T11:00:00Z 2015-05-08T01:08:25Z <partinfo>BBa_B0015</partinfo> Released HQ 2013 This is a RFC12 compatible version of <partinfo>BBa_B0015</partinfo>. It is a double terminator with close to 1 forward efficiency and around .62 reverse efficiency. See BBa_B0015 for more information including folding of the terminator and efficiency data. false false _41_ 0 6384 41 In stock false PCR amplified off of <partinfo>BBa_J04450</partinfo> with primers: GTTTCTT C GAATTC GCGGCCGC T ACTAGT CCAGGCATCAAATAAAACGAAAGGCTC, Term-F GTTTCTT C CTGCAG CGGCCGC T GCTAGC TATAAACGCAGAAAGGCCCACCCG, Term-R false Joseph Lynch annotation2074748 1 stem_loop range2074748 1 12 58 annotation2074749 1 T7 TE range2074749 1 96 115 annotation2074750 1 PolyA range2074750 1 116 128 BBa_J70612_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z