BBa_J70616 1 BBa_J70616 glnS with removal of Dam site? 2010-07-29T11:00:00Z 2015-05-08T01:08:25Z combination of info from Schultz paper and Ryu job talk, not sure the identity of the sequence that precedes the promoter in the paper from Ryu Schultz paper AAAAAACTAACAGTTGTCAGCCTGTCCCGCTTATAATATCATACGCCGT In the paper they have extra sequence that precedes it, however CC CGG GTC ATC AAT CAT CCC CAT AAT CCT TGT TAG ATT ATC AAT TTTAAAAAACTAACAGTTGTCAGCCTGTCCCGCTTATAATATCATACGCCGTTATACGTTGTTTACGCTTTGAGGAATCCCATATG false false _41_ 0 1201 41 No part sequence false aligning -10 site to the BioBrick standard false Julie Norville igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z