BBa_J70593 1 BBa_J70593 RFC12 ATG Head Domain 2010-06-17T11:00:00Z 2015-05-08T01:08:25Z Common knowledge. A RFC12 compatible part that codes for a single amino acid, methionine. This is a head domain meant to be assembled directly in front of internal domains. Please remember that modification of the first few codons can drastically affect translation efficiency. If you are worried about modification of the N-terminal design your own head domain with the first two or three codons included. false false _41_ 0 6384 41 Not in stock false Made with synthetic 5' AATTC GCGGCGC T ACTAGT ATG GCTAGC A GCGGCCG CTGCA 3', Head-F 5' GCGGCCGCTGCTAGC CAT ACTAGTAGCGCCGCG 3', Head-R Note that both primers were ordered phosphorylated. An alternative is to phosphorylate the primers yourself with a kinase. false Joseph Lynch annotation2071256 1 start range2071256 1 1 3 BBa_J70611 1 BBa_J70611 RFC12 RFP Internal Domain 2010-07-19T11:00:00Z 2015-05-08T01:08:25Z <partinfo>BBa_E1010</partinfo> An RFC12 compatible part based off of <partinfo>BBa_E1010</partinfo>. This is a RFP protein meant for use as a reporter. Note that this is an internal domain and therefore requires a head and tail domain to proceed and succeed it respectively. false false _41_ 0 6384 41 Not in stock false PCR amplified off of <partinfo>BBa_J04450</partinfo> with primers: GTTTCTT C GAATTC GCGGCCGC T ACTAGT GCTTCCTCCGAAGACGTTATCAAAGAG, RFP-F GTTTCTT C CTGCAG CGGCCGC T GCTAGC AGCACCGGTGGAGTGACGAC, RFP-R false Joseph Lynch annotation2074747 1 RFP range2074747 1 1 670 BBa_J70625 1 BBa_J70625 RFC12 RFP Coding region 2010-08-09T11:00:00Z 2015-05-08T01:08:25Z Assembled This is a RFC12 compatible cds, which means that the internal domain has been assembled with an ATG start codon as well as a double stop codon part. <bold>Note</bold> The assembly scars shown below are incorrect as of 8/10/10. The scar should be GCTAGT. false false _41_ 0 6384 41 Not in stock false None false Joseph Lynch component2077067 1 BBa_J70593 component2077071 1 BBa_J70594 component2077069 1 BBa_J70611 annotation2077071 1 BBa_J70594 range2077071 1 692 697 annotation2077069 1 BBa_J70611 range2077069 1 12 683 annotation2077067 1 BBa_J70593 range2077067 1 1 3 BBa_J70594 1 BBa_J70594 RFC12 TAATAA Tail Domain 2010-06-17T11:00:00Z 2015-05-08T01:08:25Z Common Knowledge A RFC12 compatible part that simply codes for two stop codons. This part does not have any degradation tag. false true _41_ 0 6384 41 Not in stock false Made with synthetic oligos: 5' AATTC GCGGCGC T ACTAGT TAATAA GCTAGC A GCGGCCG CTGCA 3' 5' GCGGCCGCTGCTAGC TTATTA ACTAGTAGCGCCGC G 3' Note that both primers were ordered phosphorylated. An alternative is to phosphorylate the primers yourself with a kinase. false Joseph Lynch annotation2071257 1 stop range2071257 1 1 5 BBa_J70594_sequence 1 taataa BBa_J70593_sequence 1 atg BBa_J70625_sequence 1 atgtactagaggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttactagagtaataa BBa_J70611_sequence 1 gcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z