BBa_J70627 1 BBa_J70627 RFC12 Internal Chitin Binding Domain 2010-08-10T11:00:00Z 2015-05-08T01:08:25Z NEB plasmid: [http://www.neb.com/nebecomm/products/productN6702.asp pTYB2] This is a RFC12 (SpeI,NheI) compatible chitin binding domain. It is an internal domain meant for either N or C terminal fusions. false false _41_ 0 6384 41 Not in stock false Both sequences in 5' -> 3' direction. Forward Primer: GTTTCTT C GAATTC GCGGCCGC T ACTAGT ACAAATCCTGGTGTATCCGCTTGGC Reverse Primer: GTTTCTT C CTGCAG CGGCCGC T GCTAGC TTGAAGCTGCCACAAGGCAGGAAC false Joseph Lynch annotation2077413 1 Chitin Binding Domain range2077413 1 1 153 BBa_J70627_sequence 1 acgacaaatcctggtgtatccgcttggcaggtcaacacagcttatactgcgggacaattggtcacatataacggcaagacgtataaatgtttgcagccccacacctccttggcaggatgggaaccatccaacgttcctgccttgtggcagcttcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z