BBa_J70637 1 BBa_J70637 rbs VioA rbs VioB 2010-11-18T12:00:00Z 2015-05-08T01:08:25Z derived from K274002 Prefix: GCGGCCGCTTCTAGAGTTAAGGAGGTAAAAAAAATGAAACATTCTTCC Suffix: TBD derived from K274002 false false _41_ 0 1201 41 No part sequence false there was a sequence between the stop codon of vioB and rbs of vioC in original part false Julie Norville igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z