BBa_J70655 1 BBa_J70655 RFP optimized for expression in E. coli and M. florum 2010-12-01T12:00:00Z 2015-05-08T01:08:25Z Design, DNA2.0 Codon optimized version of red fluorescent protein, optimized for dual expression in E. coli and M. florum. Includes an RBS and CDS. Designed to express well in either species. Designed with Gene Designer and made by DNA 2.0, provided in their pJ201 plasmid with Kan resistance. false false _42_41_48_1_ 0 6 48 Not in stock false Restriction site elimination, coding bias, elimination of CGG codon. false Tom Knight annotation2114854 1 MF-RED range2114854 1 52 699 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation2000 1 -35 range2000 1 20 25 annotation1999 1 lac O1 range1999 1 3 19 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_J70665 1 BBa_J70665 MF optimized RFP reporter 2011-04-04T11:00:00Z 2015-05-08T01:08:25Z composite R0011 pLac promoter with J70655 RFP false false _41_48_1_ 0 6 48 Not in stock false None false Tom Knight component2115778 1 BBa_J70655 component2115772 1 BBa_R0011 annotation2115772 1 BBa_R0011 range2115772 1 1 54 annotation2115778 1 BBa_J70655 range2115778 1 64 762 BBa_J70665_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa BBa_J70655_sequence 1 tcacacaggaaagactagatggctagtagtgaggatataatcaaagagtttatgcgttttaaagttcacatggaaggttcagtaaacggacatgaatttgaaattgagggagaaggagagggtcgtccgtacgaaggtacacaaacagcaaagttaaaagtaacaaaaggaggacctttaccatttgcatgggatattctttctccacaatttatgtatggtagtaaagcgtatgttaaacacccggcagatataccagactatttaaagttgagttttccggaaggattcaaatgggaacgtgttatgaattttgaagatggtggtgttgttacagttactcaagatagtagcttacaggatggtgaatttatttacaaagtaaaattacgtggtactaacttcccgagcgatggtccagtaatgcaaaagaaaactatgggatgggaggctagttctgaacgtatgtatcctgaagacggtgctttaaaaggagaaattaaacaacgtttgaaacttaaagatggtggacactacgatgcagaagttaaaactacatataaagctaaaaagcctgttcagcttccgggtgcttataatgtgaatataaaattagatatcacaagtcataacgaagattatactattgttgaacagtatgaaagagcagaaggaagacattctacaggagcataataa BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z