BBa_J70701 1 BBa_J70701 Test promoter 2014-01-17T12:00:00Z 2015-05-08T01:08:26Z E. coli This is a test of the Add a Basic Part system false false _1_ 0 747 63 No part sequence false ttgacggctagctcagtcctaggtacagtgctagc false Kim de Mora igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z