BBa_J72005 1 BBa_J72005 {Ptet} promoter in BBb 2008-07-15T11:00:00Z 2015-05-08T01:08:26Z <pre> PCR ca1091F/R on pSB1A2-r0040 (~100 bp, EcoRI/BamHI) Sub into pBca9145-Bca1089 (EcoRI/BamHI) Product is pBca9145-Bca1091 ---- ca1091F Forward EcoRI/BglII for Ptet part ttctggaattcatgAGATCTtccctatcagtgatagag ca1091R Reverse BamHI for Ptet part GtttGGATCCgtgctcagtatctctatc </pre> Released HQ 2013 Equivalent part to r0040, but in BBb format. In house, part is referred to as pBca9145-Bca1091 {Ptet}. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 483 171 In stock false N/A false John Anderson BBa_J72005_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z