BBa_J72018 1 BBa_J72018 {Bmll40} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll40 {rbs_at_10000.E>}=== <pre> Wobble mll40/mll41 (108, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll40 {rbs_at_10000.E>} ---- mll40 Forward wobble for {rbs_at_10000.E>} (Bmll40) CCATAGAATTCATGAGATCTCACATAGCGGCGCTAAATAATAGGGAGGCGATTCAATGGGTGCTCCG mll41 Reverse wobble for {rbs_at_10000.E>} (Bmll40) CGTTAGGATCCACGTGGTTCCAGTGGATCTGGATATGGAACCGGAGCACCCATTGAATC </pre> {rbs_at_10000.E} N terminal E tag: RBS with an E tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073906 1 E tag range2073906 1 44 83 annotation2073905 1 RBS at 10000 range2073905 1 6 41 BBa_J72018_sequence 1 gatctcacatagcggcgctaaataatagggaggcgattcaatgggtgctccggttccatatccagatccactggaaccacgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z