BBa_J72019 1 BBa_J72019 {Bmll54} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll54 {rbs_at_10000.FLAG>}=== <pre> Wobble mll54/mll55 (97, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll54 {rbs_at_10000.FLAG>} ---- mll54 Forward wobble for {rbs_at_10000.FLAG>} (Bmll54) CCATAGAATTCATGAGATCTGGGACAATCCCGGTCTTTAAGAACAGGAATTACATGTCTGAC mll55 Reverse wobble for {rbs_at_10000.FLAG>} (Bmll54) CGTTAGGATCCCTTGTCGTCGTCATCCTTGTAATCGTCAGACATGTAATTCCTG </pre> {rbs_at_10000.FLAG} N terminal flag tag: RBS with a FLAG tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073908 1 FLAG tag range2073908 1 42 69 annotation2073907 1 RBS at 10000 range2073907 1 6 39 BBa_J72019_sequence 1 gatctgggacaatcccggtctttaagaacaggaattacatgtctgacgattacaaggatgacgacgacaagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z