BBa_J72020 1 BBa_J72020 {Bmll50} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll50 {rbs_at_10000.HA>}=== <pre> Wobble mll50/mll51 (100, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll50 {rbs_at_10000.HA>} ---- mll50 Forward wobble for {rbs_at_10000.HA>} (Bmll50) CCATAGAATTCATGAGATCTTAAGCACCCATAGAATACACACCTGGAGGAATAATGTCTTACC mll51 Reverse wobble for {rbs_at_10000.HA>} (Bmll50) CGTTAGGATCCCCCAGCGTAGTCTGGGACGTCGTATGGGTAAGACATTATTCCTC </pre> {rbs_at_10000.HA} N terminal HA tag: RBS with an HA tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073910 1 HA tag range2073910 1 42 75 annotation2073909 1 RBS at 10000 range2073909 1 6 39 BBa_J72020_sequence 1 gatcttaagcacccatagaatacacacctggaggaataatgtcttacccatacgacgtcccagactacgctgggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z