BBa_J72025 1 BBa_J72025 {Bmll52} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll52 {rbs_at_10000.T7>}=== <pre> Wobble mll52/mll53 (98, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll52 {rbs_at_10000.T7>} ---- mll52 Forward wobble for {rbs_at_10000.T7>} (Bmll52) CCATAGAATTCATGAGATCTGTACCAAATTAAAAAAATCAAAACGGGGTAAGATATGGCTTC mll53 Reverse wobble for {rbs_at_10000.T7>} (Bmll52) CGTTAGGATCCACCCATTTGCTGACCGCCAGTCATAGAAGCCATATCTTACCCC </pre> {rbs_at_10000.T7} N terminal T7 tag with RBS. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073923 1 T7 tag range2073923 1 43 73 annotation2073922 1 RBS at 10000 range2073922 1 6 40 BBa_J72025_sequence 1 gatctgtaccaaattaaaaaaatcaaaacggggtaagatatggcttctatgactggcggtcagcaaatgggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z