BBa_J72028 1 BBa_J72028 {Bmll76} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (wobble construction) ===Wobble construction of Bmll76 {<6XHis!}=== <pre> Wobble mll76/mll77 (52, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll76 {<6XHis!} ---- mll76 Forward wobble for {<6XHis!} (Bmll76) CCATAGAATTCATGAGATCTCACCAtCAtCACCAtC mll77 Reverse wobble for {<6XHis!} (Bmll76) CGTTAGGATCCttaGTGaTGGTGaTGaTGGTGAGATCT </pre> {6XHis!} C terminal 6XHis tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073931 1 6XHis tag range2073931 1 6 24 BBa_J72028_sequence 1 gatctcaccatcatcaccatcactaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z