BBa_J72032 1 BBa_J72032 {Bmll58} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll58 {<S!}=== <pre> Wobble mll58/mll59 (79, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll58 {<S!} ---- mll58 Forward wobble for {<S!} (Bmll58) CCATAGAATTCATGAGATCTAAAGAAACCGCTGCTGCTAAATTCGAACGTCAG mll59 Reverse wobble for {<S!} (Bmll58) CGTTAGGATCCTTAGGAATCCATGTGCTGACGTTCGAATTTAGC </pre> {S!} C terminal S tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073937 1 S tag range2073937 1 6 51 BBa_J72032_sequence 1 gatctaaagaaaccgctgctgctaaattcgaacgtcagcacatggattcctaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z