BBa_J72033 1 BBa_J72033 {Bmll70} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll70 {<Strep!}=== <pre> Wobble mll70/mll71 (61, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll70 {<Strep!} ---- mll70 Forward wobble for {<Strep!} (Bmll70) CCATAGAATTCATGAGATCTacctggagccacccgcagttcgaa mll71 Reverse wobble for {<Strep!} (Bmll70) CGTTAGGATCCttatttttcgaactgcgggtgg </pre> {Strep!} C terminal Strep tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073938 1 Strep Tag range2073938 1 6 33 BBa_J72033_sequence 1 gatctacctggagccacccgcagttcgaaaaataag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z