BBa_J72034 1 BBa_J72034 {Bmll68} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll68 {<T7!}=== <pre> Wobble mll68/mll69 (67, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll68 {<T7!} ---- mll68 Forward wobble for {<T7!} (Bmll68) CCATAGAATTCATGAGATCTATGGCTTCTATGACTGGCGGTCAGC mll69 Reverse wobble for {<T7!} (Bmll68) CGTTAGGATCCttaACCCATTTGCTGACCGCCAGTCATAG </pre> {T7!} C terminal T7 tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073939 1 T7 tag range2073939 1 6 39 BBa_J72034_sequence 1 gatctatggcttctatgactggcggtcagcaaatgggttaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z